Every cell in our body contains DNA, the genetic code that controls the production of everything in our bodies (cells, tissues, organs) and makes us who we are i.e. humans and not potatoes (in most cases)!

There are two types - nuclear/chromosomal DNA which is found in the nucleus of every cell and is arranged into 23 pairs of chromosomes; and mitochondrial DNA which is found in the mitochondria (energy-producing structures within every cell). For the purposes of the Spearin Y-DNA Project, we are only interested in the chromosomal DNA, and specifically the Y chromosome. We'll look closer at the structure of this DNA later.

There are 23 pairs of chromosomes in every human cell (46 altogether) and together they form the human genome. You can see in the diagram that each chromosome within each pair is a similar length to its sister chromosome, but their contents (the genes) are not identical. The exception is pair number 23, the sex chromosomes (by the way, all the chromosomes in the remaining 22 pairs are called autosomes). This last pair has one long X chromosome and one short Y chromosome. The sex chromosomes determine our gender - females have two X chromosomes, whereas males have one X and one Y chromosome. Thus, the diagram shows the total chromosome signature (karyotype) for a man, written as 46, XY. The chromosome signature for a woman is 46, XX (i.e. 46 chromosomes in total, including two X chromosomes).

The Y-chromosome is the smallest of all the chromosomes and contains very little genetic material compared to the other chromosomes. From the point of view of the family researcher, a useful characteristic of the Y-chromosome is that it is passed on from father to son virtually unchanged, generation after generation, with little variation. And of course the other thing that is passed (largely) unchanged from father to son, generation after generation, is the surname! So when we find someone with the same surname we may ask ourselves: I wonder if they're related to me? ... and testing the Y-chromosome can supply the answer because if the two people have exactly the same Y-chromosome, then it must have come from a common ancestor sometime in the last 1000 years or so (i.e. since the invention of surnames)!

The genetic code - one long railway track

You'll see from the first diagram that DNA in a chromosome is arranged in a long chain (the double helix) that is heavily coiled and twisted, so much so that if you were to uncoil it and stretch it out in a straight line it would be 6 feet long! And that's just one chromosome!

If you looked at this uncoiled chromosome under a microscope, it might look like a railway track[1], stretching from London to Aberdeen, or Sydney to Perth, or New Jersey to Los Angeles. The track consists of the two metal rails (two parallel backbones of sugar and phosphate molecules) and the wooden sleepers. Each 'sleeper' along this track represents a 'base pair', either T bound to A, or C bound to G, where T, A, C, and G are the 'nucleotides' thymine, adenosine, cytosine or guanine. The important thing to note is that T can only bind to A (and vice versa) and C can only bind to G (and vice versa).

So if we were to follow the nucleotides attached to a single rail, they might read something like: TTAGCTCCTGGAATACAGATCGATA ... and this is the genetic code. Clusters of these letters (i.e. base pairs) make up a gene. So all along the chromosome, there is a sequence of genes, interspersed with codes for turning the gene on and off, as well as junk DNA (that doesn't code for anything).

Reproduction - how we pass our genetic code to the next generation

Before we look at reproduction, let's look at the process called 'mitosis'. The cells in our bodies are constantly renewing themselves. They do this by dividing in two to form two new cells (mitosis). But in order to preserve the number of chromosomes in each cell, they first have to make new versions of all 46 chromosomes and then divide them equally between the two new cells. They do this by first of all 'unzipping' the DNA molecule in each chromosome (i.e. splitting the railway track in half, right up the middle, all the way to Aberdeen) and then rebuilding an extra half on to each half track to make it whole again. In short, each railway track is split in two and then each half is used as a template to reconstruct two exact replicas of the original. One replica of each chromosome is passed on to each of the two new cells so that they each end up with 46 chromosomes in total. For more information on mitosis, visit http://en.wikipedia.org/wiki/Mitosis

In reproduction, the process of cell division ('meiosis') is slightly different. New human beings are created when a male sex cell (the sperm) unites with a female sex cell (the egg). Each of these sex cells contains only half of the chromosomes of a normal cell. In other words, instead of containing 23 chromosome pairs (i.e. 46 chromosomes), they only contain 23 single chromosomes. When the cells unite, the 23 chromosomes in each cell pair up with each other and the full quota of 46 chromosomes is restored. This is how we get half our chromosomes from our mother and half from our father.

Why do the sex cells only have 23 chromosomes? Well, in the original cell, each of the chromosomes still unzips, and two replicas of the original are still produced, but the cell, instead of splitting once, splits twice! And instead of producing two new cells, it produces four! So first the chromosomes are doubled (from 46 to 92), then split in two (back to 46), and then split in two again (down to 23). And it is only by uniting with another sex cell (during fertilization/conception) that the full quota of 46 chromosomes will be restored.

The sex chromosomes undergo the same process as all the other chromosomes - unzipping, replication, and allocation to one of the four new cells. However, here's an interesting thing. Women have two X chromosomes in pair 23, men have an X and a Y. So women will produce 4 sex cells that each contain an X chromosome, whereas men will produce 4 sex cells, two of which will contain an X chromosome and two a Y chromosome. So the gender of the new human being will depend on which of the male sex cells unites with the female sex cell - if it's a Y-containing sperm it will produce a boy (XY), if it's an X-containing sperm it will produce a girl (XX).

The animation below shows an extra step in the process that is not discussed above, namely 'recombination' - this is where two chromosomes 'swap' bits with each other. This is a very important step in the process but has no relevance to the discussion about Y-DNA inheritance (because the Y-chromosome does not 'swap' genes with the X-chromosome) . However, it is a very very relevant step for all the other 22 pairs of 'autosomes' and will be discussed further when we talk about the 'Family Finder' test in the next section.

Check out some cool video tutorials on the basics of genetic genealogy at http://www.genetree.com/tutorials